cpython-lru_cache-weakref: Tools/stringbench/stringbench.py annotate

annotate Tools/stringbench/stringbench.py @ 84007:dbfbdf2b5c19 3.3

Fix #17967: For ftp urls CWD to target instead of hopping to each directory towards target. This fixes a bug where target is accessible, but parent directories are restricted.

author	Senthil Kumaran <senthil@uthcode.com>
date	Sat, 01 Jun 2013 08:27:06 -0700
parents	24e0850be06d
children	c57d99a8fc42 d853354e1470

rev	line source
76179 704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	2 # Various microbenchmarks comparing unicode and byte string performance
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	3 # Please keep this file both 2.x and 3.x compatible!
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	4
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	5 import timeit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	6 import itertools
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	7 import operator
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	8 import re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	9 import sys
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	10 import datetime
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	11 import optparse
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	12
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	13 VERSION = '2.0'
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	14
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	15 def p(*args):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	16 sys.stdout.write(' '.join(str(s) for s in args) + '\n')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	17
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	18 if sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	19 BYTES = bytes_from_str = lambda x: x.encode('ascii')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	20 UNICODE = unicode_from_str = lambda x: x
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	21 else:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	22 BYTES = bytes_from_str = lambda x: x
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	23 UNICODE = unicode_from_str = lambda x: x.decode('ascii')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	24
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	25 class UnsupportedType(TypeError):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	26 pass
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	27
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	28
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	29 p('stringbench v%s' % VERSION)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	30 p(sys.version)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	31 p(datetime.datetime.now())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	32
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	33 REPEAT = 1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	34 REPEAT = 3
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	35 #REPEAT = 7
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	36
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	37 if __name__ != "__main__":
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	38 raise SystemExit("Must run as main program")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	39
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	40 parser = optparse.OptionParser()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	41 parser.add_option("-R", "--skip-re", dest="skip_re",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	42 action="store_true",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	43 help="skip regular expression tests")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	44 parser.add_option("-8", "--8-bit", dest="bytes_only",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	45 action="store_true",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	46 help="only do 8-bit string benchmarks")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	47 parser.add_option("-u", "--unicode", dest="unicode_only",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	48 action="store_true",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	49 help="only do Unicode string benchmarks")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	50
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	51
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	52 _RANGE_1000 = list(range(1000))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	53 _RANGE_100 = list(range(100))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	54 _RANGE_10 = list(range(10))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	55
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	56 dups = {}
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	57 def bench(s, group, repeat_count):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	58 def blah(f):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	59 if f.__name__ in dups:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	60 raise AssertionError("Multiple functions with same name: %r" %
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	61 (f.__name__,))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	62 dups[f.__name__] = 1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	63 f.comment = s
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	64 f.is_bench = True
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	65 f.group = group
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	66 f.repeat_count = repeat_count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	67 return f
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	68 return blah
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	69
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	70 def uses_re(f):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	71 f.uses_re = True
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	72
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	73 ####### 'in' comparisons
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	74
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	75 @bench('"A" in "A"*1000', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	76 def in_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	77 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	78 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	79 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	80 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	81
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	82 @bench('"B" in "A"*1000', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	83 def in_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	84 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	85 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	86 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	87 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	88
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	89
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	90 @bench('"AB" in "AB"*1000', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	91 def in_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	92 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	93 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	94 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	95 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	96
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	97 @bench('"BC" in "AB"*1000', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	98 def in_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	99 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	100 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	101 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	102 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	103
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	104 @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	105 def in_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	106 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	107 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	108 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	109 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	110
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	111 @bench('s="ABC"33; (s+"E") in ((s+"D")300+s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	112 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	113 def in_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	114 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	115 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	116 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	117 s1 = (m+d)*300 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	118 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	119 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	120 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	121
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	122 # Try with regex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	123 @uses_re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	124 @bench('s="ABC"33; re.compile(s+"D").search((s+"D")300+s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	125 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	126 def re_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	127 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	128 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	129 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	130 s1 = (m+d)*300 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	131 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	132 pat = re.compile(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	133 search = pat.search
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	134 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	135 search(s1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	136
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	137
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	138 #### same tests as 'in' but use 'find'
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	139
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	140 @bench('("A"*1000).find("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	141 def find_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	142 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	143 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	144 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	145 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	146 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	147
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	148 @bench('("A"*1000).find("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	149 def find_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	150 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	151 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	152 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	153 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	154 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	155
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	156
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	157 @bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	158 def find_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	159 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	160 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	161 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	162 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	163 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	164
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	165 @bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	166 def find_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	167 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	168 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	169 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	170 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	171 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	172
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	173 @bench('("AB"*1000).find("CA")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	174 def find_test_no_match_two_character_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	175 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	176 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	177 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	178 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	179 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	180
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	181 @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	182 def find_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	183 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	184 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	185 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	186 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	187 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	188
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	189 @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	190 def find_test_slow_match_two_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	191 s1 = STR("AB" * 300+"CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	192 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	193 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	194 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	195 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	196
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	197 @bench('s="ABC"33; ((s+"D")500+s+"E").find(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	198 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	199 def find_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	200 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	201 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	202 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	203 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	204 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	205 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	206 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	207 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	208
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	209 @bench('s="ABC"33; ((s+"D")500+"E"+s).find("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	210 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	211 def find_test_slow_match_100_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	212 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	213 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	214 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	215 s1 = (m+d)*500 + e+m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	216 s2 = e+m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	217 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	218 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	219 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	220
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	221
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	222 #### Same tests for 'rfind'
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	223
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	224 @bench('("A"*1000).rfind("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	225 def rfind_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	226 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	227 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	228 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	229 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	230 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	231
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	232 @bench('("A"*1000).rfind("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	233 def rfind_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	234 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	235 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	236 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	237 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	238 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	239
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	240
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	241 @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	242 def rfind_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	243 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	244 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	245 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	246 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	247 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	248
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	249 @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	250 def rfind_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	251 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	252 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	253 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	254 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	255 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	256
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	257 @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	258 def rfind_test_no_match_two_character_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	259 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	260 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	261 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	262 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	263 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	264
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	265 @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	266 def rfind_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	267 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	268 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	269 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	270 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	271 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	272
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	273 @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	274 def rfind_test_slow_match_two_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	275 s1 = STR("BC" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	276 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	277 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	278 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	279 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	280
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	281 @bench('s="ABC"33; ("E"+s+("D"+s)500).rfind("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	282 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	283 def rfind_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	284 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	285 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	286 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	287 s1 = e+m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	288 s2 = e+m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	289 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	290 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	291 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	292
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	293 @bench('s="ABC"33; (s+"E"+("D"+s)500).rfind(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	294 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	295 def rfind_test_slow_match_100_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	296 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	297 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	298 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	299 s1 = m+e + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	300 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	301 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	302 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	303 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	304
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	305
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	306 #### Now with index.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	307 # Skip the ones which fail because that would include exception overhead.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	308
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	309 @bench('("A"*1000).index("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	310 def index_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	311 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	312 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	313 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	314 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	315 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	316
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	317 @bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	318 def index_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	319 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	320 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	321 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	322 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	323 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	324
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	325 @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	326 def index_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	327 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	328 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	329 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	330 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	331 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	332
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	333 @bench('s="ABC"33; ((s+"D")500+s+"E").index(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	334 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	335 def index_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	336 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	337 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	338 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	339 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	340 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	341 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	342 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	343 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	344
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	345
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	346 #### Same for rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	347
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	348 @bench('("A"*1000).rindex("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	349 def rindex_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	350 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	351 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	352 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	353 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	354 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	355
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	356 @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	357 def rindex_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	358 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	359 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	360 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	361 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	362 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	363
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	364 @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	365 def rindex_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	366 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	367 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	368 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	369 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	370 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	371
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	372 @bench('s="ABC"33; ("E"+s+("D"+s)500).rindex("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	373 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	374 def rindex_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	375 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	376 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	377 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	378 s1 = e + m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	379 s2 = e + m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	380 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	381 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	382 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	383
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	384
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	385 #### Same for partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	386
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	387 @bench('("A"*1000).partition("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	388 def partition_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	389 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	390 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	391 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	392 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	393 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	394
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	395 @bench('("A"*1000).partition("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	396 def partition_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	397 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	398 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	399 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	400 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	401 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	402
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	403
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	404 @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	405 def partition_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	406 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	407 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	408 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	409 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	410 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	411
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	412 @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	413 def partition_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	414 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	415 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	416 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	417 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	418 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	419
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	420 @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	421 def partition_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	422 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	423 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	424 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	425 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	426 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	427
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	428 @bench('s="ABC"33; ((s+"D")500+s+"E").partition(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	429 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	430 def partition_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	431 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	432 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	433 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	434 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	435 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	436 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	437 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	438 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	439
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	440
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	441 #### Same for rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	442
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	443 @bench('("A"*1000).rpartition("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	444 def rpartition_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	445 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	446 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	447 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	448 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	449 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	450
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	451 @bench('("A"*1000).rpartition("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	452 def rpartition_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	453 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	454 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	455 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	456 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	457 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	458
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	459
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	460 @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	461 def rpartition_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	462 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	463 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	464 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	465 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	466 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	467
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	468 @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	469 def rpartition_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	470 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	471 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	472 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	473 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	474 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	475
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	476 @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	477 def rpartition_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	478 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	479 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	480 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	481 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	482 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	483
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	484 @bench('s="ABC"33; ("E"+s+("D"+s)500).rpartition("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	485 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	486 def rpartition_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	487 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	488 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	489 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	490 s1 = e + m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	491 s2 = e + m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	492 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	493 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	494 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	495
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	496
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	497 #### Same for split(s, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	498
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	499 @bench('("A"*1000).split("A", 1)', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	500 def split_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	501 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	502 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	503 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	504 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	505 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	506
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	507 @bench('("A"*1000).split("B", 1)', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	508 def split_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	509 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	510 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	511 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	512 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	513 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	514
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	515
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	516 @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	517 def split_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	518 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	519 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	520 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	521 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	522 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	523
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	524 @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	525 def split_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	526 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	527 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	528 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	529 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	530 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	531
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	532 @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	533 def split_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	534 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	535 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	536 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	537 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	538 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	539
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	540 @bench('s="ABC"33; ((s+"D")500+s+"E").split(s+"E", 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	541 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	542 def split_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	543 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	544 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	545 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	546 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	547 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	548 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	549 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	550 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	551
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	552
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	553 #### Same for rsplit(s, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	554
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	555 @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	556 def rsplit_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	557 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	558 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	559 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	560 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	561 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	562
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	563 @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	564 def rsplit_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	565 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	566 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	567 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	568 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	569 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	570
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	571
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	572 @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	573 def rsplit_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	574 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	575 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	576 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	577 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	578 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	579
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	580 @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	581 def rsplit_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	582 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	583 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	584 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	585 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	586 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	587
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	588 @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	589 def rsplit_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	590 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	591 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	592 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	593 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	594 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	595
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	596 @bench('s="ABC"33; ("E"+s+("D"+s)500).rsplit("E"+s, 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	597 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	598 def rsplit_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	599 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	600 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	601 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	602 s1 = e + m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	603 s2 = e + m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	604 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	605 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	606 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	607
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	608
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	609 #### Benchmark the operator-based methods
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	610
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	611 @bench('"A"*10', "repeat 1 character 10 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	612 def repeat_single_10_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	613 s = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	614 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	615 s * 10
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	616
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	617 @bench('"A"*1000', "repeat 1 character 1000 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	618 def repeat_single_1000_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	619 s = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	620 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	621 s * 1000
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	622
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	623 @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	624 def repeat_5_10_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	625 s = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	626 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	627 s * 10
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	628
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	629 @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	630 def repeat_5_1000_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	631 s = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	632 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	633 s * 1000
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	634
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	635 # + for concat
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	636
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	637 @bench('"Andrew"+"Dalke"', "concat two strings", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	638 def concat_two_strings(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	639 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	640 s2 = STR("Dalke")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	641 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	642 s1+s2
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	643
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	644 @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	645 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	646 def concat_many_strings(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	647 s1=STR('TIXSGYNREDCVBHJ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	648 s2=STR('PUMTLXBZVDO')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	649 s3=STR('FVZNJ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	650 s4=STR('OGDXUW')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	651 s5=STR('WEIMRNCOYVGHKB')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	652 s6=STR('FCQTNMXPUZH')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	653 s7=STR('TICZJYRLBNVUEAK')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	654 s8=STR('REYB')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	655 s9=STR('PWUOQ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	656 s10=STR('EQHCMKBS')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	657 s11=STR('AEVDFOH')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	658 s12=STR('IFHVD')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	659 s13=STR('JGTCNLXWOHQ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	660 s14=STR('ITSKEPYLROZAWXF')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	661 s15=STR('THEK')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	662 s16=STR('GHPZFBUYCKMNJIT')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	663 s17=STR('JMUZ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	664 s18=STR('WLZQMTB')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	665 s19=STR('KPADCBW')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	666 s20=STR('TNJHZQAGBU')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	667 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	668 (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	669 s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	670
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	671
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	672 #### Benchmark join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	673
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	674 def get_bytes_yielding_seq(STR, arg):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	675 if STR is BYTES and sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	676 raise UnsupportedType
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	677 return STR(arg)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	678
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	679 @bench('"A".join("")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	680 "join empty string, with 1 character sep", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	681 def join_empty_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	682 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	683 s2 = get_bytes_yielding_seq(STR, "")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	684 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	685 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	686 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	687
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	688 @bench('"ABCDE".join("")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	689 "join empty string, with 5 character sep", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	690 def join_empty_5(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	691 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	692 s2 = get_bytes_yielding_seq(STR, "")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	693 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	694 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	695 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	696
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	697 @bench('"A".join("ABC..Z")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	698 "join string with 26 characters, with 1 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	699 def join_alphabet_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	700 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	701 s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	702 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	703 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	704 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	705
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	706 @bench('"ABCDE".join("ABC..Z")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	707 "join string with 26 characters, with 5 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	708 def join_alphabet_5(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	709 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	710 s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	711 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	712 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	713 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	714
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	715 @bench('"A".join(list("ABC..Z"))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	716 "join list of 26 characters, with 1 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	717 def join_alphabet_list_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	718 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	719 s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	720 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	721 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	722 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	723
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	724 @bench('"ABCDE".join(list("ABC..Z"))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	725 "join list of 26 characters, with 5 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	726 def join_alphabet_list_five(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	727 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	728 s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	729 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	730 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	731 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	732
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	733 @bench('"A".join(["Bob"]*100))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	734 "join list of 100 words, with 1 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	735 def join_100_words_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	736 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	737 s2 = [STR("Bob")]*100
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	738 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	739 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	740 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	741
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	742 @bench('"ABCDE".join(["Bob"]*100))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	743 "join list of 100 words, with 5 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	744 def join_100_words_5(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	745 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	746 s2 = [STR("Bob")]*100
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	747 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	748 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	749 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	750
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	751 #### split tests
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	752
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	753 @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	754 def whitespace_split(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	755 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	756 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	757 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	758 s_split()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	759
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	760 @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	761 def whitespace_rsplit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	762 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	763 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	764 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	765 s_rsplit()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	766
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	767 @bench('("Here are some words. "*2).split(None, 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	768 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	769 def whitespace_split_1(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	770 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	771 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	772 N = None
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	773 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	774 s_split(N, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	775
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	776 @bench('("Here are some words. "*2).rsplit(None, 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	777 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	778 def whitespace_rsplit_1(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	779 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	780 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	781 N = None
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	782 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	783 s_rsplit(N, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	784
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	785 @bench('("Here are some words. "*2).partition(" ")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	786 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	787 def whitespace_partition(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	788 sep = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	789 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	790 s_partition = s.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	791 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	792 s_partition(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	793
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	794 @bench('("Here are some words. "*2).rpartition(" ")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	795 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	796 def whitespace_rpartition(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	797 sep = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	798 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	799 s_rpartition = s.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	800 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	801 s_rpartition(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	802
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	803 human_text = """\
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	804 Python is a dynamic object-oriented programming language that can be
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	805 used for many kinds of software development. It offers strong support
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	806 for integration with other languages and tools, comes with extensive
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	807 standard libraries, and can be learned in a few days. Many Python
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	808 programmers report substantial productivity gains and feel the language
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	809 encourages the development of higher quality, more maintainable code.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	810
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	811 Python runs on Windows, Linux/Unix, Mac OS X, OS/2, Amiga, Palm
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	812 Handhelds, and Nokia mobile phones. Python has also been ported to the
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	813 Java and .NET virtual machines.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	814
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	815 Python is distributed under an OSI-approved open source license that
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	816 makes it free to use, even for commercial products.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	817 """*25
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	818 human_text_bytes = bytes_from_str(human_text)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	819 human_text_unicode = unicode_from_str(human_text)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	820 def _get_human_text(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	821 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	822 return human_text_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	823 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	824 return human_text_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	825 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	826
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	827 @bench('human_text.split()', "split whitespace (huge)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	828 def whitespace_split_huge(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	829 s = _get_human_text(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	830 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	831 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	832 s_split()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	833
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	834 @bench('human_text.rsplit()', "split whitespace (huge)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	835 def whitespace_rsplit_huge(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	836 s = _get_human_text(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	837 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	838 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	839 s_rsplit()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	840
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	841
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	842
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	843 @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	844 def newlines_split(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	845 s = STR("this\nis\na\ntest\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	846 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	847 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	848 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	849 s_split(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	850
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	851
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	852 @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	853 def newlines_rsplit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	854 s = STR("this\nis\na\ntest\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	855 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	856 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	857 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	858 s_rsplit(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	859
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	860 @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	861 def newlines_splitlines(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	862 s = STR("this\nis\na\ntest\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	863 s_splitlines = s.splitlines
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	864 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	865 s_splitlines()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	866
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	867 ## split text with 2000 newlines
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	868
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	869 def _make_2000_lines():
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	870 import random
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	871 r = random.Random(100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	872 chars = list(map(chr, range(32, 128)))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	873 i = 0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	874 while i < len(chars):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	875 chars[i] = " "
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	876 i += r.randrange(9)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	877 s = "".join(chars)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	878 s = s*4
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	879 words = []
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	880 for i in range(2000):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	881 start = r.randrange(96)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	882 n = r.randint(5, 65)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	883 words.append(s[start:start+n])
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	884 return "\n".join(words)+"\n"
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	885
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	886 _text_with_2000_lines = _make_2000_lines()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	887 _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	888 _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	889 def _get_2000_lines(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	890 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	891 return _text_with_2000_lines_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	892 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	893 return _text_with_2000_lines_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	894 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	895
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	896
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	897 @bench('"...text...".split("\\n")', "split 2000 newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	898 def newlines_split_2000(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	899 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	900 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	901 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	902 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	903 s_split(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	904
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	905 @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	906 def newlines_rsplit_2000(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	907 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	908 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	909 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	910 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	911 s_rsplit(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	912
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	913 @bench('"...text...".splitlines()', "split 2000 newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	914 def newlines_splitlines_2000(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	915 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	916 s_splitlines = s.splitlines
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	917 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	918 s_splitlines()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	919
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	920
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	921 ## split text on "--" characters
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	922 @bench(
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	923 '"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	924 "split on multicharacter separator (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	925 def split_multichar_sep_small(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	926 s = STR("this--is--a--test--of--the--emergency--broadcast--system")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	927 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	928 pat = STR("--")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	929 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	930 s_split(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	931 @bench(
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	932 '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	933 "split on multicharacter separator (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	934 def rsplit_multichar_sep_small(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	935 s = STR("this--is--a--test--of--the--emergency--broadcast--system")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	936 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	937 pat = STR("--")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	938 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	939 s_rsplit(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	940
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	941 ## split dna text on "ACTAT" characters
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	942 @bench('dna.split("ACTAT")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	943 "split on multicharacter separator (dna)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	944 def split_multichar_sep_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	945 s = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	946 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	947 pat = STR("ACTAT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	948 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	949 s_split(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	950
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	951 @bench('dna.rsplit("ACTAT")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	952 "split on multicharacter separator (dna)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	953 def rsplit_multichar_sep_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	954 s = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	955 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	956 pat = STR("ACTAT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	957 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	958 s_rsplit(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	959
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	960
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	961
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	962 ## split with limits
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	963
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	964 GFF3_example = "\t".join([
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	965 "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	966 "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	967
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	968 @bench('GFF3_example.split("\\t")', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	969 def tab_split_no_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	970 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	971 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	972 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	973 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	974 s_split(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	975
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	976 @bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	977 def tab_split_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	978 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	979 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	980 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	981 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	982 s_split(sep, 8)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	983
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	984 @bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	985 def tab_rsplit_no_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	986 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	987 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	988 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	989 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	990 s_rsplit(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	991
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	992 @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	993 def tab_rsplit_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	994 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	995 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	996 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	997 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	998 s_rsplit(sep, 8)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	999
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1000 #### Count characters
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1001
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1002 @bench('...text.with.2000.newlines.count("\\n")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1003 "count newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1004 def count_newlines(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1005 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1006 s_count = s.count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1007 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1008 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1009 s_count(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1010
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1011 # Orchid sequences concatenated, from Biopython
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1012 _dna = """
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1013 CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1014 AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1015 AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1016 TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1017 AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1018 TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1019 CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1020 TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1021 GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1022 TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1023 GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1024 ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1025 CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1026 ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1027 ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1028 TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1029 CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1030 GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1031 ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1032 ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1033 ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1034 GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1035 TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1036 TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1037 TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1038 GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1039 GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1040 AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1041 GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1042 TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1043 CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1044 TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1045 TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1046 AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1047 GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1048 GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1049 CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1050 GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1051 TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1052 ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1053 GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1054 AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1055 AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1056 ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1057 GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1058 GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1059 AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1060 GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1061 ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1062 GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1063 """
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1064 _dna = "".join(_dna.splitlines())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1065 _dna = _dna * 25
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1066 _dna_bytes = bytes_from_str(_dna)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1067 _dna_unicode = unicode_from_str(_dna)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1068
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1069 def _get_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1070 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1071 return _dna_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1072 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1073 return _dna_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1074 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1075
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1076 @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1077 def count_aact(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1078 seq = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1079 seq_count = seq.count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1080 needle = STR("AACT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1081 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1082 seq_count(needle)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1083
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1084 ##### startswith and endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1085
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1086 @bench('"Andrew".startswith("A")', 'startswith single character', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1087 def startswith_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1088 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1089 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1090 s1_startswith = s1.startswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1091 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1092 s1_startswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1093
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1094 @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1095 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1096 def startswith_multiple(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1097 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1098 s2 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1099 s1_startswith = s1.startswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1100 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1101 s1_startswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1102
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1103 @bench('"Andrew".startswith("Anders")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1104 'startswith multiple characters - not!', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1105 def startswith_multiple_not(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1106 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1107 s2 = STR("Anders")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1108 s1_startswith = s1.startswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1109 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1110 s1_startswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1111
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1112
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1113 # endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1114
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1115 @bench('"Andrew".endswith("w")', 'endswith single character', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1116 def endswith_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1117 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1118 s2 = STR("w")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1119 s1_endswith = s1.endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1120 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1121 s1_endswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1122
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1123 @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1124 def endswith_multiple(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1125 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1126 s2 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1127 s1_endswith = s1.endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1128 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1129 s1_endswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1130
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1131 @bench('"Andrew".endswith("Anders")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1132 'endswith multiple characters - not!', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1133 def endswith_multiple_not(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1134 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1135 s2 = STR("Anders")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1136 s1_endswith = s1.endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1137 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1138 s1_endswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1139
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1140 #### Strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1141
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1142 @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1143 def terminal_newline_strip_right(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1144 s = STR("Hello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1145 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1146 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1147 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1148
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1149 @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1150 def terminal_newline_rstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1151 s = STR("Hello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1152 s_rstrip = s.rstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1153 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1154 s_rstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1155
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1156 @bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1157 def terminal_newline_strip_left(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1158 s = STR("\nHello!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1159 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1160 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1161 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1162
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1163 @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1164 def terminal_newline_strip_both(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1165 s = STR("\nHello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1166 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1167 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1168 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1169
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1170 @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1171 def terminal_newline_lstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1172 s = STR("\nHello!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1173 s_lstrip = s.lstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1174 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1175 s_lstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1176
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1177 @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1178 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1179 def terminal_newline_if_else(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1180 s = STR("Hello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1181 NL = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1182 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1183 s[:-1] if (s[-1] == NL) else s
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1184
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1185
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1186 # Strip multiple spaces or tabs
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1187
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1188 @bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1189 def terminal_space_strip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1190 s = STR("Hello\t \t!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1191 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1192 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1193 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1194
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1195 @bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1196 def terminal_space_rstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1197 s = STR("Hello!\t \t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1198 s_rstrip = s.rstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1199 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1200 s_rstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1201
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1202 @bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1203 def terminal_space_lstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1204 s = STR("\t \tHello!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1205 s_lstrip = s.lstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1206 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1207 s_lstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1208
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1209
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1210 #### replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1211 @bench('"This is a test".replace(" ", "\\t")', 'replace single character',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1212 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1213 def replace_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1214 s = STR("This is a test!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1215 from_str = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1216 to_str = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1217 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1218 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1219 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1220
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1221 @uses_re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1222 @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1223 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1224 def replace_single_character_re(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1225 s = STR("This is a test!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1226 pat = re.compile(STR(" "))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1227 to_str = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1228 pat_sub = pat.sub
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1229 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1230 pat_sub(to_str, s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1231
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1232 @bench('"...text.with.2000.lines...replace("\\n", " ")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1233 'replace single character, big string', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1234 def replace_single_character_big(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1235 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1236 from_str = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1237 to_str = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1238 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1239 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1240 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1241
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1242 @uses_re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1243 @bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1244 'replace single character, big string', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1245 def replace_single_character_big_re(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1246 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1247 pat = re.compile(STR("\n"))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1248 to_str = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1249 pat_sub = pat.sub
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1250 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1251 pat_sub(to_str, s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1252
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1253
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1254 @bench('dna.replace("ATC", "ATT")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1255 'replace multiple characters, dna', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1256 def replace_multiple_characters_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1257 seq = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1258 from_str = STR("ATC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1259 to_str = STR("ATT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1260 seq_replace = seq.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1261 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1262 seq_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1263
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1264 # This increases the character count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1265 @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1266 'replace and expand multiple characters, big string', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1267 def replace_multiple_character_big(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1268 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1269 from_str = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1270 to_str = STR("\r\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1271 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1272 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1273 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1274
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1275
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1276 # This decreases the character count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1277 @bench('"When shall we three meet again?".replace("ee", "")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1278 'replace/remove multiple characters', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1279 def replace_multiple_character_remove(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1280 s = STR("When shall we three meet again?")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1281 from_str = STR("ee")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1282 to_str = STR("")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1283 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1284 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1285 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1286
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1287
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1288 big_s = "A" + ("Z"1281024)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1289 big_s_bytes = bytes_from_str(big_s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1290 big_s_unicode = unicode_from_str(big_s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1291 def _get_big_s(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1292 if STR is UNICODE: return big_s_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1293 if STR is BYTES: return big_s_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1294 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1295
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1296 # The older replace implementation counted all matches in
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1297 # the string even when it only neeed to make one replacement.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1298 @bench('("A" + ("Z"1281024)).replace("A", "BB", 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1299 'quick replace single character match', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1300 def quick_replace_single_match(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1301 s = _get_big_s(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1302 from_str = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1303 to_str = STR("BB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1304 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1305 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1306 s_replace(from_str, to_str, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1307
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1308 @bench('("A" + ("Z"1281024)).replace("AZZ", "BBZZ", 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1309 'quick replace multiple character match', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1310 def quick_replace_multiple_match(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1311 s = _get_big_s(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1312 from_str = STR("AZZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1313 to_str = STR("BBZZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1314 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1315 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1316 s_replace(from_str, to_str, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1317
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1318
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1319 ####
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1320
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1321 # CCP does a lot of this, for internationalisation of ingame messages.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1322 _format = "The %(thing)s is %(place)s the %(location)s."
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1323 _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1324 _format_bytes = bytes_from_str(_format)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1325 _format_unicode = unicode_from_str(_format)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1326 _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1327 _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1328
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1329 def _get_format(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1330 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1331 return _format_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1332 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1333 if sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1334 raise UnsupportedType
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1335 return _format_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1336 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1337
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1338 def _get_format_dict(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1339 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1340 return _format_dict_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1341 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1342 if sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1343 raise UnsupportedType
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1344 return _format_dict_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1345 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1346
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1347 # Formatting.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1348 @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1349 'formatting a string type with a dict', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1350 def format_with_dict(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1351 s = _get_format(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1352 d = _get_format_dict(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1353 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1354 s % d
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1355
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1356
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1357 #### Upper- and lower- case conversion
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1358
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1359 @bench('("Where in the world is Carmen San Deigo?"*10).lower()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1360 "case conversion -- rare", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1361 def lower_conversion_rare(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1362 s = STR("Where in the world is Carmen San Deigo?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1363 s_lower = s.lower
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1364 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1365 s_lower()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1366
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1367 @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1368 "case conversion -- dense", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1369 def lower_conversion_dense(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1370 s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1371 s_lower = s.lower
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1372 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1373 s_lower()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1374
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1375
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1376 @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1377 "case conversion -- rare", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1378 def upper_conversion_rare(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1379 s = STR("Where in the world is Carmen San Deigo?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1380 s_upper = s.upper
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1381 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1382 s_upper()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1383
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1384 @bench('("where in the world is carmen san deigo?"*10).upper()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1385 "case conversion -- dense", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1386 def upper_conversion_dense(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1387 s = STR("where in the world is carmen san deigo?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1388 s_upper = s.upper
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1389 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1390 s_upper()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1391
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1392
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1393 # end of benchmarks
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1394
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1395 #################
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1396
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1397 class BenchTimer(timeit.Timer):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1398 def best(self, repeat=1):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1399 for i in range(1, 10):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1400 number = 10**i
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1401 x = self.timeit(number)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1402 if x > 0.02:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1403 break
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1404 times = [x]
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1405 for i in range(1, repeat):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1406 times.append(self.timeit(number))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1407 return min(times) / number
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1408
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1409 def main():
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1410 (options, test_names) = parser.parse_args()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1411 if options.bytes_only and options.unicode_only:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1412 raise SystemExit("Only one of --8-bit and --unicode are allowed")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1413
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1414 bench_functions = []
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1415 for (k,v) in globals().items():
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1416 if hasattr(v, "is_bench"):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1417 if test_names:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1418 for name in test_names:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1419 if name in v.group:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1420 break
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1421 else:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1422 # Not selected, ignore
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1423 continue
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1424 if options.skip_re and hasattr(v, "uses_re"):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1425 continue
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1426
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1427 bench_functions.append( (v.group, k, v) )
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1428 bench_functions.sort()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1429
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1430 p("bytes\tunicode")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1431 p("(in ms)\t(in ms)\t%\tcomment")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1432
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1433 bytes_total = uni_total = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1434
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1435 for title, group in itertools.groupby(bench_functions,
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1436 operator.itemgetter(0)):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1437 # Flush buffer before each group
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1438 sys.stdout.flush()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1439 p("="*10, title)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1440 for (_, k, v) in group:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1441 if hasattr(v, "is_bench"):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1442 bytes_time = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1443 bytes_time_s = " - "
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1444 if not options.unicode_only:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1445 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1446 bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,),
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1447 "import __main__").best(REPEAT)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1448 bytes_time_s = "%.2f" % (1000 * bytes_time)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1449 bytes_total += bytes_time
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1450 except UnsupportedType:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1451 bytes_time_s = "N/A"
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1452 uni_time = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1453 uni_time_s = " - "
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1454 if not options.bytes_only:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1455 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1456 uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,),
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1457 "import __main__").best(REPEAT)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1458 uni_time_s = "%.2f" % (1000 * uni_time)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1459 uni_total += uni_time
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1460 except UnsupportedType:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1461 uni_time_s = "N/A"
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1462 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1463 average = bytes_time/uni_time
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1464 except (TypeError, ZeroDivisionError):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1465 average = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1466 p("%s\t%s\t%.1f\t%s (*%d)" % (
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1467 bytes_time_s, uni_time_s, 100.*average,
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1468 v.comment, v.repeat_count))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1469
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1470 if bytes_total == uni_total == 0.0:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1471 p("That was zippy!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1472 else:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1473 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1474 ratio = bytes_total/uni_total
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1475 except ZeroDivisionError:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1476 ratio = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1477 p("%.2f\t%.2f\t%.1f\t%s" % (
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1478 1000bytes_total, 1000uni_total, 100.*ratio,
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1479 "TOTAL"))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1480
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1481 if __name__ == "__main__":
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1482 main()

Mercurial > cpython-lru_cache-weakref

annotate Tools/stringbench/stringbench.py @ 84007:dbfbdf2b5c19 3.3