cpython-lru_cache-weakref: Tools/stringbench/stringbench.py annotate

annotate Tools/stringbench/stringbench.py @ 87690:66c1c9f32567 default tip

Add use_weakref option to functools.lru_cache The use_weakref option makes lru_cache create weak references to the function arguments when creating the cache key, which prevents them from staying in the memory forever even after all other references to them are gone. This is a proof of concept for http://bugs.python.org/issue19859

author	Radomir Dopieralski <devel@sheep.art.pl>
date	Tue, 03 Dec 2013 16:02:48 +0100
parents	6b28bfff9204
children

rev	line source
76179 704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	2 # Various microbenchmarks comparing unicode and byte string performance
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	3 # Please keep this file both 2.x and 3.x compatible!
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	4
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	5 import timeit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	6 import itertools
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	7 import operator
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	8 import re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	9 import sys
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	10 import datetime
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	11 import optparse
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	12
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	13 VERSION = '2.0'
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	14
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	15 def p(*args):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	16 sys.stdout.write(' '.join(str(s) for s in args) + '\n')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	17
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	18 if sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	19 BYTES = bytes_from_str = lambda x: x.encode('ascii')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	20 UNICODE = unicode_from_str = lambda x: x
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	21 else:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	22 BYTES = bytes_from_str = lambda x: x
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	23 UNICODE = unicode_from_str = lambda x: x.decode('ascii')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	24
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	25 class UnsupportedType(TypeError):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	26 pass
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	27
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	28
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	29 p('stringbench v%s' % VERSION)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	30 p(sys.version)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	31 p(datetime.datetime.now())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	32
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	33 REPEAT = 1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	34 REPEAT = 3
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	35 #REPEAT = 7
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	36
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	37 if __name__ != "__main__":
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	38 raise SystemExit("Must run as main program")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	39
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	40 parser = optparse.OptionParser()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	41 parser.add_option("-R", "--skip-re", dest="skip_re",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	42 action="store_true",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	43 help="skip regular expression tests")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	44 parser.add_option("-8", "--8-bit", dest="bytes_only",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	45 action="store_true",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	46 help="only do 8-bit string benchmarks")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	47 parser.add_option("-u", "--unicode", dest="unicode_only",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	48 action="store_true",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	49 help="only do Unicode string benchmarks")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	50
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	51
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	52 _RANGE_1000 = list(range(1000))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	53 _RANGE_100 = list(range(100))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	54 _RANGE_10 = list(range(10))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	55
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	56 dups = {}
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	57 def bench(s, group, repeat_count):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	58 def blah(f):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	59 if f.__name__ in dups:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	60 raise AssertionError("Multiple functions with same name: %r" %
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	61 (f.__name__,))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	62 dups[f.__name__] = 1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	63 f.comment = s
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	64 f.is_bench = True
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	65 f.group = group
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	66 f.repeat_count = repeat_count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	67 return f
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	68 return blah
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	69
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	70 def uses_re(f):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	71 f.uses_re = True
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	72
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	73 ####### 'in' comparisons
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	74
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	75 @bench('"A" in "A"*1000', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	76 def in_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	77 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	78 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	79 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	80 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	81
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	82 @bench('"B" in "A"*1000', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	83 def in_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	84 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	85 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	86 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	87 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	88
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	89
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	90 @bench('"AB" in "AB"*1000', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	91 def in_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	92 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	93 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	94 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	95 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	96
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	97 @bench('"BC" in "AB"*1000', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	98 def in_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	99 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	100 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	101 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	102 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	103
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	104 @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	105 def in_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	106 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	107 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	108 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	109 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	110
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	111 @bench('s="ABC"33; (s+"E") in ((s+"D")300+s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	112 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	113 def in_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	114 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	115 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	116 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	117 s1 = (m+d)*300 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	118 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	119 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	120 s2 in s1
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	121
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	122 # Try with regex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	123 @uses_re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	124 @bench('s="ABC"33; re.compile(s+"D").search((s+"D")300+s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	125 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	126 def re_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	127 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	128 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	129 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	130 s1 = (m+d)*300 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	131 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	132 pat = re.compile(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	133 search = pat.search
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	134 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	135 search(s1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	136
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	137
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	138 #### same tests as 'in' but use 'find'
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	139
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	140 @bench('("A"*1000).find("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	141 def find_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	142 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	143 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	144 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	145 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	146 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	147
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	148 @bench('("A"*1000).find("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	149 def find_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	150 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	151 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	152 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	153 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	154 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	155
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	156
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	157 @bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	158 def find_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	159 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	160 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	161 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	162 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	163 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	164
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	165 @bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	166 def find_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	167 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	168 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	169 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	170 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	171 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	172
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	173 @bench('("AB"*1000).find("CA")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	174 def find_test_no_match_two_character_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	175 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	176 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	177 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	178 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	179 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	180
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	181 @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	182 def find_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	183 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	184 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	185 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	186 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	187 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	188
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	189 @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	190 def find_test_slow_match_two_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	191 s1 = STR("AB" * 300+"CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	192 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	193 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	194 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	195 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	196
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	197 @bench('s="ABC"33; ((s+"D")500+s+"E").find(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	198 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	199 def find_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	200 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	201 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	202 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	203 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	204 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	205 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	206 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	207 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	208
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	209 @bench('s="ABC"33; ((s+"D")500+"E"+s).find("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	210 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	211 def find_test_slow_match_100_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	212 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	213 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	214 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	215 s1 = (m+d)*500 + e+m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	216 s2 = e+m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	217 s1_find = s1.find
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	218 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	219 s1_find(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	220
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	221
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	222 #### Same tests for 'rfind'
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	223
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	224 @bench('("A"*1000).rfind("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	225 def rfind_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	226 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	227 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	228 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	229 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	230 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	231
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	232 @bench('("A"*1000).rfind("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	233 def rfind_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	234 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	235 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	236 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	237 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	238 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	239
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	240
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	241 @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	242 def rfind_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	243 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	244 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	245 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	246 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	247 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	248
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	249 @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	250 def rfind_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	251 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	252 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	253 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	254 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	255 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	256
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	257 @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	258 def rfind_test_no_match_two_character_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	259 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	260 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	261 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	262 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	263 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	264
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	265 @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	266 def rfind_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	267 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	268 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	269 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	270 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	271 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	272
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	273 @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	274 def rfind_test_slow_match_two_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	275 s1 = STR("BC" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	276 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	277 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	278 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	279 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	280
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	281 @bench('s="ABC"33; ("E"+s+("D"+s)500).rfind("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	282 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	283 def rfind_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	284 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	285 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	286 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	287 s1 = e+m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	288 s2 = e+m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	289 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	290 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	291 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	292
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	293 @bench('s="ABC"33; (s+"E"+("D"+s)500).rfind(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	294 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	295 def rfind_test_slow_match_100_characters_bis(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	296 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	297 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	298 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	299 s1 = m+e + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	300 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	301 s1_rfind = s1.rfind
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	302 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	303 s1_rfind(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	304
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	305
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	306 #### Now with index.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	307 # Skip the ones which fail because that would include exception overhead.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	308
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	309 @bench('("A"*1000).index("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	310 def index_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	311 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	312 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	313 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	314 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	315 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	316
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	317 @bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	318 def index_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	319 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	320 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	321 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	322 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	323 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	324
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	325 @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	326 def index_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	327 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	328 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	329 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	330 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	331 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	332
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	333 @bench('s="ABC"33; ((s+"D")500+s+"E").index(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	334 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	335 def index_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	336 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	337 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	338 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	339 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	340 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	341 s1_index = s1.index
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	342 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	343 s1_index(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	344
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	345
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	346 #### Same for rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	347
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	348 @bench('("A"*1000).rindex("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	349 def rindex_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	350 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	351 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	352 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	353 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	354 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	355
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	356 @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	357 def rindex_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	358 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	359 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	360 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	361 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	362 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	363
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	364 @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	365 def rindex_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	366 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	367 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	368 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	369 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	370 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	371
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	372 @bench('s="ABC"33; ("E"+s+("D"+s)500).rindex("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	373 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	374 def rindex_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	375 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	376 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	377 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	378 s1 = e + m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	379 s2 = e + m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	380 s1_rindex = s1.rindex
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	381 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	382 s1_rindex(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	383
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	384
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	385 #### Same for partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	386
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	387 @bench('("A"*1000).partition("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	388 def partition_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	389 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	390 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	391 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	392 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	393 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	394
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	395 @bench('("A"*1000).partition("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	396 def partition_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	397 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	398 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	399 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	400 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	401 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	402
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	403
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	404 @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	405 def partition_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	406 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	407 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	408 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	409 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	410 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	411
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	412 @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	413 def partition_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	414 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	415 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	416 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	417 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	418 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	419
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	420 @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	421 def partition_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	422 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	423 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	424 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	425 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	426 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	427
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	428 @bench('s="ABC"33; ((s+"D")500+s+"E").partition(s+"E")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	429 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	430 def partition_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	431 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	432 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	433 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	434 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	435 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	436 s1_partition = s1.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	437 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	438 s1_partition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	439
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	440
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	441 #### Same for rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	442
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	443 @bench('("A"*1000).rpartition("A")', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	444 def rpartition_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	445 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	446 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	447 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	448 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	449 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	450
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	451 @bench('("A"*1000).rpartition("B")', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	452 def rpartition_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	453 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	454 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	455 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	456 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	457 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	458
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	459
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	460 @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	461 def rpartition_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	462 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	463 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	464 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	465 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	466 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	467
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	468 @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	469 def rpartition_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	470 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	471 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	472 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	473 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	474 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	475
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	476 @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	477 def rpartition_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	478 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	479 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	480 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	481 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	482 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	483
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	484 @bench('s="ABC"33; ("E"+s+("D"+s)500).rpartition("E"+s)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	485 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	486 def rpartition_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	487 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	488 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	489 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	490 s1 = e + m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	491 s2 = e + m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	492 s1_rpartition = s1.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	493 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	494 s1_rpartition(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	495
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	496
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	497 #### Same for split(s, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	498
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	499 @bench('("A"*1000).split("A", 1)', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	500 def split_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	501 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	502 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	503 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	504 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	505 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	506
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	507 @bench('("A"*1000).split("B", 1)', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	508 def split_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	509 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	510 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	511 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	512 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	513 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	514
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	515
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	516 @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	517 def split_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	518 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	519 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	520 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	521 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	522 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	523
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	524 @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	525 def split_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	526 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	527 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	528 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	529 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	530 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	531
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	532 @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	533 def split_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	534 s1 = STR("AB" * 300+"C")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	535 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	536 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	537 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	538 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	539
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	540 @bench('s="ABC"33; ((s+"D")500+s+"E").split(s+"E", 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	541 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	542 def split_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	543 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	544 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	545 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	546 s1 = (m+d)*500 + m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	547 s2 = m+e
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	548 s1_split = s1.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	549 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	550 s1_split(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	551
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	552
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	553 #### Same for rsplit(s, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	554
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	555 @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	556 def rsplit_test_quick_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	557 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	558 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	559 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	560 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	561 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	562
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	563 @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	564 def rsplit_test_no_match_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	565 s1 = STR("A" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	566 s2 = STR("B")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	567 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	568 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	569 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	570
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	571
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	572 @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	573 def rsplit_test_quick_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	574 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	575 s2 = STR("AB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	576 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	577 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	578 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	579
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	580 @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	581 def rsplit_test_no_match_two_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	582 s1 = STR("AB" * 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	583 s2 = STR("BC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	584 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	585 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	586 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	587
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	588 @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	589 def rsplit_test_slow_match_two_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	590 s1 = STR("C" + "AB" * 300)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	591 s2 = STR("CA")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	592 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	593 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	594 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	595
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	596 @bench('s="ABC"33; ("E"+s+("D"+s)500).rsplit("E"+s, 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	597 "late match, 100 characters", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	598 def rsplit_test_slow_match_100_characters(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	599 m = STR("ABC"*33)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	600 d = STR("D")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	601 e = STR("E")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	602 s1 = e + m + (d+m)*500
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	603 s2 = e + m
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	604 s1_rsplit = s1.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	605 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	606 s1_rsplit(s2, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	607
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	608
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	609 #### Benchmark the operator-based methods
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	610
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	611 @bench('"A"*10', "repeat 1 character 10 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	612 def repeat_single_10_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	613 s = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	614 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	615 s * 10
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	616
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	617 @bench('"A"*1000', "repeat 1 character 1000 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	618 def repeat_single_1000_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	619 s = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	620 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	621 s * 1000
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	622
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	623 @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	624 def repeat_5_10_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	625 s = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	626 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	627 s * 10
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	628
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	629 @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	630 def repeat_5_1000_times(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	631 s = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	632 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	633 s * 1000
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	634
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	635 # + for concat
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	636
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	637 @bench('"Andrew"+"Dalke"', "concat two strings", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	638 def concat_two_strings(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	639 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	640 s2 = STR("Dalke")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	641 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	642 s1+s2
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	643
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	644 @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	645 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	646 def concat_many_strings(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	647 s1=STR('TIXSGYNREDCVBHJ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	648 s2=STR('PUMTLXBZVDO')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	649 s3=STR('FVZNJ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	650 s4=STR('OGDXUW')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	651 s5=STR('WEIMRNCOYVGHKB')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	652 s6=STR('FCQTNMXPUZH')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	653 s7=STR('TICZJYRLBNVUEAK')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	654 s8=STR('REYB')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	655 s9=STR('PWUOQ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	656 s10=STR('EQHCMKBS')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	657 s11=STR('AEVDFOH')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	658 s12=STR('IFHVD')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	659 s13=STR('JGTCNLXWOHQ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	660 s14=STR('ITSKEPYLROZAWXF')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	661 s15=STR('THEK')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	662 s16=STR('GHPZFBUYCKMNJIT')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	663 s17=STR('JMUZ')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	664 s18=STR('WLZQMTB')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	665 s19=STR('KPADCBW')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	666 s20=STR('TNJHZQAGBU')
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	667 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	668 (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	669 s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	670
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	671
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	672 #### Benchmark join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	673
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	674 def get_bytes_yielding_seq(STR, arg):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	675 if STR is BYTES and sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	676 raise UnsupportedType
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	677 return STR(arg)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	678
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	679 @bench('"A".join("")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	680 "join empty string, with 1 character sep", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	681 def join_empty_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	682 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	683 s2 = get_bytes_yielding_seq(STR, "")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	684 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	685 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	686 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	687
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	688 @bench('"ABCDE".join("")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	689 "join empty string, with 5 character sep", 100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	690 def join_empty_5(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	691 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	692 s2 = get_bytes_yielding_seq(STR, "")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	693 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	694 for x in _RANGE_100:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	695 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	696
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	697 @bench('"A".join("ABC..Z")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	698 "join string with 26 characters, with 1 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	699 def join_alphabet_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	700 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	701 s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	702 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	703 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	704 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	705
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	706 @bench('"ABCDE".join("ABC..Z")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	707 "join string with 26 characters, with 5 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	708 def join_alphabet_5(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	709 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	710 s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	711 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	712 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	713 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	714
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	715 @bench('"A".join(list("ABC..Z"))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	716 "join list of 26 characters, with 1 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	717 def join_alphabet_list_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	718 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	719 s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	720 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	721 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	722 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	723
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	724 @bench('"ABCDE".join(list("ABC..Z"))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	725 "join list of 26 characters, with 5 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	726 def join_alphabet_list_five(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	727 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	728 s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	729 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	730 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	731 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	732
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	733 @bench('"A".join(["Bob"]*100))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	734 "join list of 100 words, with 1 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	735 def join_100_words_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	736 sep = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	737 s2 = [STR("Bob")]*100
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	738 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	739 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	740 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	741
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	742 @bench('"ABCDE".join(["Bob"]*100))',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	743 "join list of 100 words, with 5 character sep", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	744 def join_100_words_5(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	745 sep = STR("ABCDE")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	746 s2 = [STR("Bob")]*100
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	747 sep_join = sep.join
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	748 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	749 sep_join(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	750
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	751 #### split tests
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	752
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	753 @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	754 def whitespace_split(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	755 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	756 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	757 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	758 s_split()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	759
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	760 @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	761 def whitespace_rsplit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	762 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	763 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	764 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	765 s_rsplit()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	766
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	767 @bench('("Here are some words. "*2).split(None, 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	768 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	769 def whitespace_split_1(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	770 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	771 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	772 N = None
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	773 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	774 s_split(N, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	775
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	776 @bench('("Here are some words. "*2).rsplit(None, 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	777 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	778 def whitespace_rsplit_1(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	779 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	780 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	781 N = None
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	782 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	783 s_rsplit(N, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	784
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	785 @bench('("Here are some words. "*2).partition(" ")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	786 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	787 def whitespace_partition(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	788 sep = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	789 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	790 s_partition = s.partition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	791 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	792 s_partition(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	793
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	794 @bench('("Here are some words. "*2).rpartition(" ")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	795 "split 1 whitespace", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	796 def whitespace_rpartition(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	797 sep = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	798 s = STR("Here are some words. "*2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	799 s_rpartition = s.rpartition
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	800 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	801 s_rpartition(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	802
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	803 human_text = """\
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	804 Python is a dynamic object-oriented programming language that can be
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	805 used for many kinds of software development. It offers strong support
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	806 for integration with other languages and tools, comes with extensive
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	807 standard libraries, and can be learned in a few days. Many Python
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	808 programmers report substantial productivity gains and feel the language
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	809 encourages the development of higher quality, more maintainable code.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	810
79479 d853354e1470 #16135: Removal of OS/2 support (Remove OS2 and OS/2 references) Jesus Cea <jcea@jcea.es> parents: 76180 diff changeset	811 Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm
76179 704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	812 Handhelds, and Nokia mobile phones. Python has also been ported to the
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	813 Java and .NET virtual machines.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	814
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	815 Python is distributed under an OSI-approved open source license that
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	816 makes it free to use, even for commercial products.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	817 """*25
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	818 human_text_bytes = bytes_from_str(human_text)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	819 human_text_unicode = unicode_from_str(human_text)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	820 def _get_human_text(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	821 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	822 return human_text_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	823 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	824 return human_text_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	825 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	826
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	827 @bench('human_text.split()', "split whitespace (huge)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	828 def whitespace_split_huge(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	829 s = _get_human_text(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	830 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	831 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	832 s_split()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	833
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	834 @bench('human_text.rsplit()', "split whitespace (huge)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	835 def whitespace_rsplit_huge(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	836 s = _get_human_text(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	837 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	838 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	839 s_rsplit()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	840
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	841
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	842
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	843 @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	844 def newlines_split(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	845 s = STR("this\nis\na\ntest\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	846 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	847 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	848 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	849 s_split(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	850
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	851
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	852 @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	853 def newlines_rsplit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	854 s = STR("this\nis\na\ntest\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	855 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	856 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	857 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	858 s_rsplit(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	859
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	860 @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	861 def newlines_splitlines(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	862 s = STR("this\nis\na\ntest\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	863 s_splitlines = s.splitlines
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	864 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	865 s_splitlines()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	866
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	867 ## split text with 2000 newlines
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	868
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	869 def _make_2000_lines():
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	870 import random
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	871 r = random.Random(100)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	872 chars = list(map(chr, range(32, 128)))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	873 i = 0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	874 while i < len(chars):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	875 chars[i] = " "
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	876 i += r.randrange(9)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	877 s = "".join(chars)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	878 s = s*4
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	879 words = []
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	880 for i in range(2000):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	881 start = r.randrange(96)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	882 n = r.randint(5, 65)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	883 words.append(s[start:start+n])
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	884 return "\n".join(words)+"\n"
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	885
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	886 _text_with_2000_lines = _make_2000_lines()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	887 _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	888 _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	889 def _get_2000_lines(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	890 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	891 return _text_with_2000_lines_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	892 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	893 return _text_with_2000_lines_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	894 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	895
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	896
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	897 @bench('"...text...".split("\\n")', "split 2000 newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	898 def newlines_split_2000(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	899 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	900 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	901 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	902 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	903 s_split(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	904
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	905 @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	906 def newlines_rsplit_2000(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	907 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	908 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	909 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	910 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	911 s_rsplit(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	912
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	913 @bench('"...text...".splitlines()', "split 2000 newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	914 def newlines_splitlines_2000(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	915 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	916 s_splitlines = s.splitlines
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	917 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	918 s_splitlines()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	919
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	920
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	921 ## split text on "--" characters
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	922 @bench(
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	923 '"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	924 "split on multicharacter separator (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	925 def split_multichar_sep_small(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	926 s = STR("this--is--a--test--of--the--emergency--broadcast--system")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	927 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	928 pat = STR("--")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	929 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	930 s_split(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	931 @bench(
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	932 '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	933 "split on multicharacter separator (small)", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	934 def rsplit_multichar_sep_small(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	935 s = STR("this--is--a--test--of--the--emergency--broadcast--system")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	936 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	937 pat = STR("--")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	938 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	939 s_rsplit(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	940
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	941 ## split dna text on "ACTAT" characters
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	942 @bench('dna.split("ACTAT")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	943 "split on multicharacter separator (dna)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	944 def split_multichar_sep_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	945 s = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	946 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	947 pat = STR("ACTAT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	948 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	949 s_split(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	950
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	951 @bench('dna.rsplit("ACTAT")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	952 "split on multicharacter separator (dna)", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	953 def rsplit_multichar_sep_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	954 s = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	955 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	956 pat = STR("ACTAT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	957 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	958 s_rsplit(pat)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	959
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	960
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	961
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	962 ## split with limits
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	963
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	964 GFF3_example = "\t".join([
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	965 "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	966 "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	967
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	968 @bench('GFF3_example.split("\\t")', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	969 def tab_split_no_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	970 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	971 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	972 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	973 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	974 s_split(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	975
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	976 @bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	977 def tab_split_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	978 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	979 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	980 s_split = s.split
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	981 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	982 s_split(sep, 8)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	983
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	984 @bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	985 def tab_rsplit_no_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	986 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	987 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	988 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	989 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	990 s_rsplit(sep)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	991
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	992 @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	993 def tab_rsplit_limit(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	994 sep = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	995 s = STR(GFF3_example)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	996 s_rsplit = s.rsplit
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	997 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	998 s_rsplit(sep, 8)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	999
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1000 #### Count characters
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1001
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1002 @bench('...text.with.2000.newlines.count("\\n")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1003 "count newlines", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1004 def count_newlines(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1005 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1006 s_count = s.count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1007 nl = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1008 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1009 s_count(nl)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1010
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1011 # Orchid sequences concatenated, from Biopython
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1012 _dna = """
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1013 CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1014 AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1015 AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1016 TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1017 AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1018 TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1019 CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1020 TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1021 GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1022 TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1023 GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1024 ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1025 CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1026 ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1027 ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1028 TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1029 CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1030 GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1031 ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1032 ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1033 ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1034 GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1035 TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1036 TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1037 TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1038 GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1039 GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1040 AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1041 GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1042 TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1043 CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1044 TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1045 TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1046 AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1047 GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1048 GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1049 CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1050 GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1051 TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1052 ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1053 GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1054 AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1055 AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1056 ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1057 GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1058 GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1059 AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1060 GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1061 ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1062 GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1063 """
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1064 _dna = "".join(_dna.splitlines())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1065 _dna = _dna * 25
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1066 _dna_bytes = bytes_from_str(_dna)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1067 _dna_unicode = unicode_from_str(_dna)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1068
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1069 def _get_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1070 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1071 return _dna_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1072 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1073 return _dna_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1074 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1075
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1076 @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1077 def count_aact(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1078 seq = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1079 seq_count = seq.count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1080 needle = STR("AACT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1081 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1082 seq_count(needle)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1083
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1084 ##### startswith and endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1085
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1086 @bench('"Andrew".startswith("A")', 'startswith single character', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1087 def startswith_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1088 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1089 s2 = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1090 s1_startswith = s1.startswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1091 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1092 s1_startswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1093
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1094 @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1095 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1096 def startswith_multiple(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1097 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1098 s2 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1099 s1_startswith = s1.startswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1100 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1101 s1_startswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1102
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1103 @bench('"Andrew".startswith("Anders")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1104 'startswith multiple characters - not!', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1105 def startswith_multiple_not(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1106 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1107 s2 = STR("Anders")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1108 s1_startswith = s1.startswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1109 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1110 s1_startswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1111
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1112
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1113 # endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1114
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1115 @bench('"Andrew".endswith("w")', 'endswith single character', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1116 def endswith_single(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1117 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1118 s2 = STR("w")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1119 s1_endswith = s1.endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1120 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1121 s1_endswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1122
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1123 @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1124 def endswith_multiple(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1125 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1126 s2 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1127 s1_endswith = s1.endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1128 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1129 s1_endswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1130
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1131 @bench('"Andrew".endswith("Anders")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1132 'endswith multiple characters - not!', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1133 def endswith_multiple_not(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1134 s1 = STR("Andrew")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1135 s2 = STR("Anders")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1136 s1_endswith = s1.endswith
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1137 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1138 s1_endswith(s2)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1139
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1140 #### Strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1141
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1142 @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1143 def terminal_newline_strip_right(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1144 s = STR("Hello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1145 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1146 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1147 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1148
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1149 @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1150 def terminal_newline_rstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1151 s = STR("Hello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1152 s_rstrip = s.rstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1153 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1154 s_rstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1155
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1156 @bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1157 def terminal_newline_strip_left(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1158 s = STR("\nHello!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1159 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1160 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1161 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1162
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1163 @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1164 def terminal_newline_strip_both(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1165 s = STR("\nHello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1166 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1167 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1168 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1169
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1170 @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1171 def terminal_newline_lstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1172 s = STR("\nHello!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1173 s_lstrip = s.lstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1174 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1175 s_lstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1176
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1177 @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1178 'strip terminal newline', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1179 def terminal_newline_if_else(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1180 s = STR("Hello!\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1181 NL = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1182 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1183 s[:-1] if (s[-1] == NL) else s
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1184
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1185
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1186 # Strip multiple spaces or tabs
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1187
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1188 @bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1189 def terminal_space_strip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1190 s = STR("Hello\t \t!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1191 s_strip = s.strip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1192 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1193 s_strip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1194
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1195 @bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1196 def terminal_space_rstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1197 s = STR("Hello!\t \t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1198 s_rstrip = s.rstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1199 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1200 s_rstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1201
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1202 @bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1203 def terminal_space_lstrip(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1204 s = STR("\t \tHello!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1205 s_lstrip = s.lstrip
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1206 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1207 s_lstrip()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1208
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1209
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1210 #### replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1211 @bench('"This is a test".replace(" ", "\\t")', 'replace single character',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1212 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1213 def replace_single_character(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1214 s = STR("This is a test!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1215 from_str = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1216 to_str = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1217 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1218 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1219 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1220
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1221 @uses_re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1222 @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1223 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1224 def replace_single_character_re(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1225 s = STR("This is a test!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1226 pat = re.compile(STR(" "))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1227 to_str = STR("\t")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1228 pat_sub = pat.sub
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1229 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1230 pat_sub(to_str, s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1231
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1232 @bench('"...text.with.2000.lines...replace("\\n", " ")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1233 'replace single character, big string', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1234 def replace_single_character_big(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1235 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1236 from_str = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1237 to_str = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1238 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1239 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1240 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1241
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1242 @uses_re
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1243 @bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1244 'replace single character, big string', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1245 def replace_single_character_big_re(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1246 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1247 pat = re.compile(STR("\n"))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1248 to_str = STR(" ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1249 pat_sub = pat.sub
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1250 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1251 pat_sub(to_str, s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1252
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1253
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1254 @bench('dna.replace("ATC", "ATT")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1255 'replace multiple characters, dna', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1256 def replace_multiple_characters_dna(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1257 seq = _get_dna(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1258 from_str = STR("ATC")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1259 to_str = STR("ATT")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1260 seq_replace = seq.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1261 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1262 seq_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1263
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1264 # This increases the character count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1265 @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1266 'replace and expand multiple characters, big string', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1267 def replace_multiple_character_big(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1268 s = _get_2000_lines(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1269 from_str = STR("\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1270 to_str = STR("\r\n")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1271 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1272 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1273 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1274
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1275
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1276 # This decreases the character count
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1277 @bench('"When shall we three meet again?".replace("ee", "")',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1278 'replace/remove multiple characters', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1279 def replace_multiple_character_remove(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1280 s = STR("When shall we three meet again?")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1281 from_str = STR("ee")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1282 to_str = STR("")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1283 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1284 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1285 s_replace(from_str, to_str)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1286
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1287
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1288 big_s = "A" + ("Z"1281024)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1289 big_s_bytes = bytes_from_str(big_s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1290 big_s_unicode = unicode_from_str(big_s)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1291 def _get_big_s(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1292 if STR is UNICODE: return big_s_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1293 if STR is BYTES: return big_s_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1294 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1295
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1296 # The older replace implementation counted all matches in
85406 c57d99a8fc42 #18803: fix more typos. Patch by Févry Thibault. Ezio Melotti <ezio.melotti@gmail.com> parents: 76180 diff changeset	1297 # the string even when it only needed to make one replacement.
76179 704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1298 @bench('("A" + ("Z"1281024)).replace("A", "BB", 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1299 'quick replace single character match', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1300 def quick_replace_single_match(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1301 s = _get_big_s(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1302 from_str = STR("A")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1303 to_str = STR("BB")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1304 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1305 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1306 s_replace(from_str, to_str, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1307
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1308 @bench('("A" + ("Z"1281024)).replace("AZZ", "BBZZ", 1)',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1309 'quick replace multiple character match', 10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1310 def quick_replace_multiple_match(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1311 s = _get_big_s(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1312 from_str = STR("AZZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1313 to_str = STR("BBZZ")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1314 s_replace = s.replace
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1315 for x in _RANGE_10:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1316 s_replace(from_str, to_str, 1)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1317
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1318
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1319 ####
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1320
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1321 # CCP does a lot of this, for internationalisation of ingame messages.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1322 _format = "The %(thing)s is %(place)s the %(location)s."
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1323 _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1324 _format_bytes = bytes_from_str(_format)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1325 _format_unicode = unicode_from_str(_format)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1326 _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1327 _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items())
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1328
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1329 def _get_format(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1330 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1331 return _format_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1332 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1333 if sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1334 raise UnsupportedType
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1335 return _format_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1336 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1337
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1338 def _get_format_dict(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1339 if STR is UNICODE:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1340 return _format_dict_unicode
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1341 if STR is BYTES:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1342 if sys.version_info >= (3,):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1343 raise UnsupportedType
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1344 return _format_dict_bytes
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1345 raise AssertionError
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1346
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1347 # Formatting.
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1348 @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1349 'formatting a string type with a dict', 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1350 def format_with_dict(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1351 s = _get_format(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1352 d = _get_format_dict(STR)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1353 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1354 s % d
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1355
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1356
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1357 #### Upper- and lower- case conversion
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1358
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1359 @bench('("Where in the world is Carmen San Deigo?"*10).lower()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1360 "case conversion -- rare", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1361 def lower_conversion_rare(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1362 s = STR("Where in the world is Carmen San Deigo?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1363 s_lower = s.lower
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1364 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1365 s_lower()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1366
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1367 @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1368 "case conversion -- dense", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1369 def lower_conversion_dense(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1370 s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1371 s_lower = s.lower
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1372 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1373 s_lower()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1374
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1375
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1376 @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1377 "case conversion -- rare", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1378 def upper_conversion_rare(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1379 s = STR("Where in the world is Carmen San Deigo?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1380 s_upper = s.upper
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1381 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1382 s_upper()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1383
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1384 @bench('("where in the world is carmen san deigo?"*10).upper()',
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1385 "case conversion -- dense", 1000)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1386 def upper_conversion_dense(STR):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1387 s = STR("where in the world is carmen san deigo?"*10)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1388 s_upper = s.upper
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1389 for x in _RANGE_1000:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1390 s_upper()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1391
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1392
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1393 # end of benchmarks
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1394
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1395 #################
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1396
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1397 class BenchTimer(timeit.Timer):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1398 def best(self, repeat=1):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1399 for i in range(1, 10):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1400 number = 10**i
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1401 x = self.timeit(number)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1402 if x > 0.02:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1403 break
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1404 times = [x]
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1405 for i in range(1, repeat):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1406 times.append(self.timeit(number))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1407 return min(times) / number
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1408
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1409 def main():
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1410 (options, test_names) = parser.parse_args()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1411 if options.bytes_only and options.unicode_only:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1412 raise SystemExit("Only one of --8-bit and --unicode are allowed")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1413
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1414 bench_functions = []
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1415 for (k,v) in globals().items():
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1416 if hasattr(v, "is_bench"):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1417 if test_names:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1418 for name in test_names:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1419 if name in v.group:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1420 break
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1421 else:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1422 # Not selected, ignore
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1423 continue
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1424 if options.skip_re and hasattr(v, "uses_re"):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1425 continue
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1426
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1427 bench_functions.append( (v.group, k, v) )
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1428 bench_functions.sort()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1429
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1430 p("bytes\tunicode")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1431 p("(in ms)\t(in ms)\t%\tcomment")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1432
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1433 bytes_total = uni_total = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1434
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1435 for title, group in itertools.groupby(bench_functions,
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1436 operator.itemgetter(0)):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1437 # Flush buffer before each group
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1438 sys.stdout.flush()
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1439 p("="*10, title)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1440 for (_, k, v) in group:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1441 if hasattr(v, "is_bench"):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1442 bytes_time = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1443 bytes_time_s = " - "
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1444 if not options.unicode_only:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1445 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1446 bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,),
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1447 "import __main__").best(REPEAT)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1448 bytes_time_s = "%.2f" % (1000 * bytes_time)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1449 bytes_total += bytes_time
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1450 except UnsupportedType:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1451 bytes_time_s = "N/A"
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1452 uni_time = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1453 uni_time_s = " - "
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1454 if not options.bytes_only:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1455 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1456 uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,),
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1457 "import __main__").best(REPEAT)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1458 uni_time_s = "%.2f" % (1000 * uni_time)
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1459 uni_total += uni_time
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1460 except UnsupportedType:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1461 uni_time_s = "N/A"
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1462 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1463 average = bytes_time/uni_time
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1464 except (TypeError, ZeroDivisionError):
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1465 average = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1466 p("%s\t%s\t%.1f\t%s (*%d)" % (
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1467 bytes_time_s, uni_time_s, 100.*average,
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1468 v.comment, v.repeat_count))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1469
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1470 if bytes_total == uni_total == 0.0:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1471 p("That was zippy!")
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1472 else:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1473 try:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1474 ratio = bytes_total/uni_total
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1475 except ZeroDivisionError:
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1476 ratio = 0.0
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1477 p("%.2f\t%.2f\t%.1f\t%s" % (
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1478 1000bytes_total, 1000uni_total, 100.*ratio,
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1479 "TOTAL"))
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1480
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1481 if __name__ == "__main__":
704630a9c5d5 Issue #13165: stringbench is now available in the Tools/stringbench folder. Antoine Pitrou <solipsis@pitrou.net> parents: diff changeset	1482 main()

Mercurial > cpython-lru_cache-weakref

annotate Tools/stringbench/stringbench.py @ 87690:66c1c9f32567 default tip